View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1410_low_7 (Length: 290)
Name: NF1410_low_7
Description: NF1410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1410_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 62 - 269
Target Start/End: Original strand, 32517879 - 32518086
Alignment:
| Q |
62 |
tttctttgtgtgtaacaaacataccttagtattttaggattgtgttttgttttgacacttcgattatcaagaaaatgagtttgtaatctagagttcaggt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
32517879 |
tttctttgtgtgtaacaaacataccttagtattttaggattgtgttttgttttgacacttcgattatcaagaaaatgagtttgtaagctagagttcagtt |
32517978 |
T |
|
| Q |
162 |
gaaagataaataaaattcgatt-aaatattatctaatctaagattctacttgaaatttttgtgagcaatttatctttaacttaaaatagttaaccaccct |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32517979 |
gaaagataaataaaattcgattaaaatattatctaat-taagattctacttgaaatttttccgagcaatttatctttaacttaaaatagttaaccaccct |
32518077 |
T |
|
| Q |
261 |
agtccacac |
269 |
Q |
| |
|
||||||||| |
|
|
| T |
32518078 |
agtccacac |
32518086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University