View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1411-Insertion-10 (Length: 102)
Name: NF1411-Insertion-10
Description: NF1411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1411-Insertion-10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 1e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 11 - 100
Target Start/End: Complemental strand, 3659794 - 3659706
Alignment:
| Q |
11 |
atgatgaacattaattaataaatcctagtcgtttgtggaccttagtttgccttgcaatttatgtatatataaaggccaaaaccacaagcc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| ||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
3659794 |
atgatcaacattaattaataaatcctagtcgtttgtgggccttactttgccttgtaa-ttatgtatatataaaggccaaaaccacaagcc |
3659706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University