View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1411-Insertion-9 (Length: 113)
Name: NF1411-Insertion-9
Description: NF1411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1411-Insertion-9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 5 - 113
Target Start/End: Complemental strand, 34770847 - 34770740
Alignment:
| Q |
5 |
acattggctatattgttgtaataccttgccttggtttggcaccatttcaccaccaaagaacacttacaatcttgcatagtgtttcaatatagttttcttc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
34770847 |
acattggctatattgttgtaataccttgccttggtttggcaccatttcaccaccaaagaacacttagaatcttgcatagtgtttcaata-agttttcttc |
34770749 |
T |
 |
| Q |
105 |
ttttatttt |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
34770748 |
ttttatttt |
34770740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University