View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14110_high_8 (Length: 261)
Name: NF14110_high_8
Description: NF14110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14110_high_8 |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0025 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 36 - 131
Target Start/End: Complemental strand, 56955 - 56862
Alignment:
| Q |
36 |
cacttgtgggatttggtggtggcctttctgatatgtgtatatactaccgaatttctcgcatcaccatttcaccaagctttcgatgggagatgtaag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56955 |
cacttgtgggatttggtggtggcctttctgat--gtgtatatactatcgaatttctcgcatcaccatttcaccaagctttcgatgggagatgtaag |
56862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University