View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14110_low_11 (Length: 284)

Name: NF14110_low_11
Description: NF14110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14110_low_11
NF14110_low_11
[»] chr7 (1 HSPs)
chr7 (113-173)||(9426513-9426573)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 113 - 173
Target Start/End: Original strand, 9426513 - 9426573
Alignment:
113 gcgtaaatgatttaaaagatcaaaataagataagataattaaaatttgagtggtggcaacc 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9426513 gcgtaaatgatttaaaagatcaaaataagataagataattaaaatttgagtggtggcaacc 9426573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University