View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14110_low_11 (Length: 284)
Name: NF14110_low_11
Description: NF14110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14110_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 113 - 173
Target Start/End: Original strand, 9426513 - 9426573
Alignment:
| Q |
113 |
gcgtaaatgatttaaaagatcaaaataagataagataattaaaatttgagtggtggcaacc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9426513 |
gcgtaaatgatttaaaagatcaaaataagataagataattaaaatttgagtggtggcaacc |
9426573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University