View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14110_low_12 (Length: 266)
Name: NF14110_low_12
Description: NF14110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14110_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 30348503 - 30348761
Alignment:
| Q |
1 |
tggtggaatgcaatctttgataggtgaagtctggatgaagttatgaccccattcatgaagagaagggaacttttcagcattaattagttccatttctcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348503 |
tggtggaatgcaatctttgataggtgaagtctggatgaagttatgaccccattcatgaagagaagggaacttttcagcattaattagttccatttctcca |
30348602 |
T |
|
| Q |
101 |
agttcttcaagaacattaagccaatatgatatccaaccagctacaatatcaagataccctatcttctctccaccaaaaaactttttcccttgaatctgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348603 |
agttcttcaagaacattaagccaatatgatatccaaccagctacaatatcaagataccctatcttctctccaccaaaaaactttttcccttgaatctgct |
30348702 |
T |
|
| Q |
201 |
tctcaagaaatgcaagtgactccactgcagcttctacagcttttgcctttgcttctcct |
259 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||||||||||||||||| |||||||| |
|
|
| T |
30348703 |
tctcaagaaatgcaagtgactctattgcagcatctacagcttttgccttttcttctcct |
30348761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University