View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_high_14 (Length: 260)
Name: NF14111_high_14
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 30497650 - 30497410
Alignment:
| Q |
18 |
ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30497650 |
ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga |
30497551 |
T |
|
| Q |
118 |
tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30497550 |
tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag |
30497451 |
T |
|
| Q |
218 |
tttctttttggatattccacctatatagaacacctttgctt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30497450 |
tttctttttggatattccacctatatagaacacctttgctt |
30497410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 30505185 - 30504952
Alignment:
| Q |
18 |
ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
30505185 |
ggttttaattggttggatggttttttggagcgcttatggtgagtagcagctgttaggat-------tttgtctatgcggtcattcgcgaggaagtgtgga |
30505093 |
T |
|
| Q |
118 |
tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag |
217 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | |
|
|
| T |
30505092 |
ggtttggatttgatttaggtgttgatttcggtttttggtgattagtttttcttatttgtgttggtgctacccgtggtgtttgtattgatgtttttgtagg |
30504993 |
T |
|
| Q |
218 |
tttctttttggatattccacctatatagaacacctttgctt |
258 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
30504992 |
cttcttttttgatgttccacctatatagaacgtctttgctt |
30504952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University