View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_high_16 (Length: 251)
Name: NF14111_high_16
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 4428546 - 4428372
Alignment:
| Q |
19 |
atgtttttcctattgaaactaccacaatatttattttagtcacgggtgtgatctgttgatagtgaacagcatttatttcctgctatggagtttgaataat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4428546 |
atgtttttcctattgaaactaccacaatatttattttagtcacgggtgtgatcggttgatagtgaacagcatttatttcctgctatggagtttgaataat |
4428447 |
T |
 |
| Q |
119 |
tgaagtattgagccccttgactaagtaaacagcagtcggcattgaattttggttcacaaccttcagcatcaacta |
193 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4428446 |
tgaagtattgaaccccttgactaagtaaacagcagtcggcattgaattttggttcacaaccttcagcatcaacta |
4428372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University