View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14111_high_25 (Length: 216)

Name: NF14111_high_25
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14111_high_25
NF14111_high_25
[»] chr2 (1 HSPs)
chr2 (16-209)||(42804825-42805018)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 42805018 - 42804825
Alignment:
16 caaaaaagttgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtcaaaccttcct 115  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
42805018 caaaaaaattgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtgaaaccttcct 42804919  T
116 ttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtatattattcga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||    
42804918 ttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtattttcttcga 42804825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University