View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_high_6 (Length: 341)
Name: NF14111_high_6
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 22 - 276
Target Start/End: Complemental strand, 47852060 - 47851806
Alignment:
| Q |
22 |
tatgattatgagacatcataaacattctgcattttgttgctttctggtttctatctgaattacgaccaatctttctgatatatacataataaatatgaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47852060 |
tatgattatgagacatcataaacattctgcattttgttgctttctggtttctatctgaattacgaccaatctttctgatatatacataataaatatgaat |
47851961 |
T |
 |
| Q |
122 |
agtctttcattaagttattgttagttgannnnnnnnnaccgaaagaatttttaatgttgaagttttcagaaaaattaaagtcgtatcatacatcattttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851960 |
agtctttcattaagttattgttagttgatttttttttaccgaaagaatttttaatgttgaagttttcagaaaaattaaagtcgtatcatacatcattttc |
47851861 |
T |
 |
| Q |
222 |
atcttctgcgctatatttcttattgtatgagagattgtttatctttcaattttag |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851860 |
atcttctgcgctatatttcttattgtatgagagattgtttatctttcaattttag |
47851806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University