View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_high_9 (Length: 307)
Name: NF14111_high_9
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 2063938 - 2063701
Alignment:
| Q |
18 |
aattagatgaaatgatacaaggaattataatattggatcttgtaaaaaggcgcaccaattatggataannnnnnnnctttctctatacaaaaatattgt- |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||| | |
|
|
| T |
2063938 |
aattagatgaaaagatacaaggaattataatattggatcttgtaaaaagacgcaccaattatggataattttttttttctctctatacaaaaatattatg |
2063839 |
T |
|
| Q |
117 |
gggttgtttt---tagtagtttgtattctttcttgccaattataatacaccatggttatgattatgnnnnnnnactaaaaatctctacttcaatctagat |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| || | |||| ||||||||||||||| |||||| |
|
|
| T |
2063838 |
gggttgtttttagtagtagtttgtattctttcttgccaattataatacaccatgattatgttttt------ttactagaaatctctacttcaaactagat |
2063745 |
T |
|
| Q |
214 |
tctatcatactcgatgatgaagtttttctttaaaagatctaaca |
257 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
2063744 |
tctatcatactcgatgataaaatttttctttaaaagatgtaaca |
2063701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University