View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_low_17 (Length: 257)
Name: NF14111_low_17
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 243
Target Start/End: Original strand, 36350481 - 36350703
Alignment:
| Q |
21 |
aacatagacaatagatccacccaatgagcacgtatccgctcaaccactctcattatagaaaaatttagtatggtcattttataaggcttgaacaatcctt |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36350481 |
aacatagacaatagatccacccagtgagcacgtatccgctcaaccactctcattatagaaaaatttagtatggtcattttataaggcttgaacaaccctt |
36350580 |
T |
 |
| Q |
121 |
gcttaccttggagctaactttaggggttgagttaggcctaattgacaaattcaaagagaaatcattgannnnnnnaattttccttacacaagctttatcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
36350581 |
gcttaccttggagctaactttaggggttgagttaggcctaattgacaaattcaaagagaaatcattgatttttttaattttccttgcacaagctttatcc |
36350680 |
T |
 |
| Q |
221 |
aaatacattatgggtttcaggtg |
243 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36350681 |
aaatacattatgggtttcaggtg |
36350703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University