View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14111_low_21 (Length: 247)
Name: NF14111_low_21
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14111_low_21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 30 - 247
Target Start/End: Complemental strand, 1846418 - 1846206
Alignment:
| Q |
30 |
ataaatagtataattatcttttaaataaattaacacttttatccttaaaattatacaatggtgttattttagtttatgatattgtttatacttcgagtgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1846418 |
ataaatagtataattatcttttaaataaattaacacctttatccttaaaattatacaatgatgttattttagtttatgatattgtttatatttcgagtgt |
1846319 |
T |
 |
| Q |
130 |
ttaacttgtttccttccttnnnnnnnnnnnnnntttgtctagtaaaaattaacgtgattgattatgaatgattatttttaaattttagtaatttcaaata |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1846318 |
ttaacttgtttccttcctt-----aaaaaaaaatttgtctagaaaaaattaacgtgattgattatgaatgattatttttaaattttagtaatttcaaata |
1846224 |
T |
 |
| Q |
230 |
tcaagctgatgttgattt |
247 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1846223 |
tcaagctgatgttgattt |
1846206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University