View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14112_high_13 (Length: 219)
Name: NF14112_high_13
Description: NF14112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14112_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 125 - 201
Target Start/End: Complemental strand, 43613245 - 43613169
Alignment:
| Q |
125 |
cttgcagctggacaaaacaatggcttggcaactttccaatccatccggaacttcaaagaaatgcattgagtggttgg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43613245 |
cttgcagctggacaaaacaatggcttggcaacttgccaatccatccggaacttcaaagaaatgcattgagtggttgg |
43613169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 125 - 201
Target Start/End: Complemental strand, 43644434 - 43644358
Alignment:
| Q |
125 |
cttgcagctggacaaaacaatggcttggcaactttccaatccatccggaacttcaaagaaatgcattgagtggttgg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
43644434 |
cttgcagctggacaaaacaatggcttggcaacttgccaatccatccggaactgcagagaaatgcattgaatggttgg |
43644358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 43613364 - 43613316
Alignment:
| Q |
18 |
ttctgcttactgcatcatctctccaaagtggtgttgactctgcctccaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43613364 |
ttctgcttactgcatcatctctccaaagtggtgttgagtctgcctccaa |
43613316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 43644515 - 43644480
Alignment:
| Q |
17 |
attctgcttactgcatcatctctccaaagtggtgtt |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43644515 |
attctgcttactacatcatctctccaaagtggtgtt |
43644480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University