View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14112_low_1 (Length: 710)
Name: NF14112_low_1
Description: NF14112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14112_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 39298916 - 39299171
Alignment:
| Q |
1 |
tgtgccgcagtccaccctgccccggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctatacagtaacat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39298916 |
tgtgccgcagtccaccctgccacggtggccttatccttcaaatcaaccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacat |
39299015 |
T |
|
| Q |
101 |
cctttgcctgaacacctgcagacttggctttctccgccactggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299016 |
cctttgcctgaacaactgcagacttggctttctccgccacaggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttc |
39299115 |
T |
|
| Q |
201 |
ataaccttgttgtgttttctcaagagttgcatctttggcttgtgctgctttctcca |
256 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39299116 |
ataaccttgttgtgttttctcaacagttgcatctttggcttgtgctgctttctcca |
39299171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 448 - 556
Target Start/End: Original strand, 39299363 - 39299471
Alignment:
| Q |
448 |
tgttcagcaccactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagctacactctttcccaagattacaccttcatttt |
547 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39299363 |
tgttcagcagcactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagcaacactctttcccaagattacaccttcatttt |
39299462 |
T |
|
| Q |
548 |
caccaccaa |
556 |
Q |
| |
|
||||||||| |
|
|
| T |
39299463 |
caccaccaa |
39299471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 332 - 417
Target Start/End: Original strand, 39299247 - 39299332
Alignment:
| Q |
332 |
catacctctcttgtgctgctgagattgcgtccatttcattttgttgtgcttggtttctatacttccctatctcttccaaagacatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299247 |
catacctctcttgtgctgctgagattgcgtccatttcattttgttgtgcttggtttctatacttccctatctcttccaaagacatt |
39299332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 647 - 710
Target Start/End: Original strand, 39299562 - 39299625
Alignment:
| Q |
647 |
cccacattaaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctc |
710 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299562 |
cccacatcgaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctc |
39299625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University