View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14112_low_12 (Length: 349)
Name: NF14112_low_12
Description: NF14112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14112_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 52 - 296
Target Start/End: Complemental strand, 43667344 - 43667102
Alignment:
| Q |
52 |
ttactatgggcattggacaagtacggatgaggccactttgctca-tatttcttactatattggaactcaaccttttcattgggacccaaaagatggagca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43667344 |
ttactatgggcattggacaagtacggatgaggcctctttgctcagtatttcttactatattggaactcatccttttcattgggacccaaaagatggagca |
43667245 |
T |
 |
| Q |
151 |
taaataaaatgaagaagaaccttggaatcaatatcatatactactagtatttttcaactttcatcttattattattggaagtttcctattccttccttct |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43667244 |
taaataaaatgaagaag---cttggaatcaataccatatactactagtatttttcaactttcatcttattattattggaagtttcctattccttccttct |
43667148 |
T |
 |
| Q |
251 |
tgtgctcatgggtccctataggaatagcaacaagatatataacacc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43667147 |
tgtgctcatgggtccctataggaatagcaacaagatatataacacc |
43667102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University