View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14114_low_7 (Length: 223)
Name: NF14114_low_7
Description: NF14114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14114_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 176
Target Start/End: Complemental strand, 6284167 - 6284007
Alignment:
| Q |
16 |
attatactattatataaaattttaaacaattatagatttcaaattgttcaaaacaacttctaaattctccaacatctcaaacctcgaatattttagggtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6284167 |
attatactattatataaaattttaaacaattatagattttaaattgttcaaaacaacttttaaattctccaacatctcaaacctcgaatattttagggtt |
6284068 |
T |
 |
| Q |
116 |
ttatttagttatacggactacccacaatctatgtgggctagcctaaattcaaaacagattc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6284067 |
ttatttagttatacggactacccacaatctatgtgggctagcctaaattcaaaacagattc |
6284007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University