View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14115_high_24 (Length: 327)

Name: NF14115_high_24
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14115_high_24
NF14115_high_24
[»] chr7 (1 HSPs)
chr7 (1-100)||(15015812-15015911)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 15015812 - 15015911
Alignment:
1 tatgtctcctatgatactccttagcattcatcaatgccacgttacacccatccacctgacaccttgtcaccgccgtataaccccccaccgccgccgtctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
15015812 tatgtctcctatgatactccttagcattcatcaatgccacgttacacccatccacctgacaccttgtcaccgccgtataacctcccaccgccgccgtctt 15015911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University