View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_high_24 (Length: 327)
Name: NF14115_high_24
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 15015812 - 15015911
Alignment:
| Q |
1 |
tatgtctcctatgatactccttagcattcatcaatgccacgttacacccatccacctgacaccttgtcaccgccgtataaccccccaccgccgccgtctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15015812 |
tatgtctcctatgatactccttagcattcatcaatgccacgttacacccatccacctgacaccttgtcaccgccgtataacctcccaccgccgccgtctt |
15015911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University