View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_high_29 (Length: 250)
Name: NF14115_high_29
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 23 - 146
Target Start/End: Complemental strand, 26450426 - 26450301
Alignment:
| Q |
23 |
ggaagctgtaacagtaggaaatccagattccataactgatcc-ataacccattttactattcacattaacctctaagttttt-atcaaatagacaagcac |
120 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||| ||||| |||| |||||||| |||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
26450426 |
ggaagctgcaacagcagaaaatccagattccataatcgatcccataatccattttaaaattcacattaacctctaagttttttattaaatagacaagcac |
26450327 |
T |
 |
| Q |
121 |
ttttcttttttattaacacaactaac |
146 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
26450326 |
ttttcttttttattaacacaattaac |
26450301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University