View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14115_high_29 (Length: 250)

Name: NF14115_high_29
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14115_high_29
NF14115_high_29
[»] chr4 (1 HSPs)
chr4 (23-146)||(26450301-26450426)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 23 - 146
Target Start/End: Complemental strand, 26450426 - 26450301
Alignment:
23 ggaagctgtaacagtaggaaatccagattccataactgatcc-ataacccattttactattcacattaacctctaagttttt-atcaaatagacaagcac 120  Q
    |||||||| ||||| || |||||||||||||||||  ||||| |||| ||||||||  |||||||||||||||||||||||| || ||||||||||||||    
26450426 ggaagctgcaacagcagaaaatccagattccataatcgatcccataatccattttaaaattcacattaacctctaagttttttattaaatagacaagcac 26450327  T
121 ttttcttttttattaacacaactaac 146  Q
    ||||||||||||||||||||| ||||    
26450326 ttttcttttttattaacacaattaac 26450301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University