View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_high_39 (Length: 224)
Name: NF14115_high_39
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 43226757 - 43226569
Alignment:
| Q |
18 |
gtttattcatgctacttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggtttagaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226757 |
gtttattcatgctacttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggtttagaag |
43226658 |
T |
 |
| Q |
118 |
atgagaaatgatcgaattttcaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcattggagctt |
206 |
Q |
| |
|
||||||| |||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226657 |
atgagaattgatcgcatatttaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgattttgtggcattggagctt |
43226569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 33 - 112
Target Start/End: Original strand, 15623144 - 15623223
Alignment:
| Q |
33 |
ttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
112 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15623144 |
ttgttggacaagggaggtgtggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15623223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 33 - 112
Target Start/End: Original strand, 15646933 - 15647012
Alignment:
| Q |
33 |
ttgttggatgagtgaggtgcggtctaaaaagcttagacgaggggcttggttaatttggcacgccgtcgtgtgggtggttt |
112 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |||||||||||||| || ||| | |||||||||| |
|
|
| T |
15646933 |
ttgttggacaagggaggtgtggtctaaaaagcttagacgaggggcgtggttaatttggcatgcggtcatttgggtggttt |
15647012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 114 - 188
Target Start/End: Original strand, 16256768 - 16256842
Alignment:
| Q |
114 |
gaagatgagaaatgatcgaattttcaatgagaaggtgtgtggagttgatgaaatggtggagcaagtcaaggtgat |
188 |
Q |
| |
|
|||||||||||||||| | |||| ||| | || || ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
16256768 |
gaagatgagaaatgatagggtttttaataacaaagtttgtggggttgatgaaatggtggatcaagtcaaggtgat |
16256842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University