View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14115_high_41 (Length: 208)

Name: NF14115_high_41
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14115_high_41
NF14115_high_41
[»] chr1 (1 HSPs)
chr1 (46-183)||(36464880-36465017)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 46 - 183
Target Start/End: Complemental strand, 36465017 - 36464880
Alignment:
46 atgtgggaaaatgaacaaaatcaaccaagcatgggagacataaattcactttgacttgtcattatggtacatttttgtagccgagaagcggaaaatataa 145  Q
    ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36465017 atgtgggaaaatgaacaaaatcaaccaggcgtgggagacataaattcactttgacttgtcattatggtacatttttgtagccgagaagcggaaaatataa 36464918  T
146 agtattctgcggttaagcttcgattgctcaattaagga 183  Q
    ||||||||||||||||||||||||||||||||||||||    
36464917 agtattctgcggttaagcttcgattgctcaattaagga 36464880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University