View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_25 (Length: 346)
Name: NF14115_low_25
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 1782263 - 1781937
Alignment:
| Q |
1 |
acagatccacccttttcttgtgtttttctcactttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttgattaaact |
100 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1782263 |
acagatcaaccctcttcttgtgtttttctcaccttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttaattaaact |
1782164 |
T |
 |
| Q |
101 |
tatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782163 |
tatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttagt |
1782064 |
T |
 |
| Q |
201 |
tttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagtttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782063 |
tttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagtttt |
1781964 |
T |
 |
| Q |
301 |
gagggtctcacgaagtcagcatgtagg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1781963 |
gagggtctcacgaagtcagcatgtagg |
1781937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University