View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_29 (Length: 291)
Name: NF14115_low_29
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 47 - 273
Target Start/End: Complemental strand, 44380431 - 44380204
Alignment:
| Q |
47 |
tagaaccaatatctcatagacagacacaaattatatatttgcttnnnnnnn-gaaacaaattatatacacagtgtgtcacacactcacattataatttat |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44380431 |
tagaaccaatatctcatagacagacacaaattatatatttgcttaaaaaaaagaaacaaattatatacacagtgtgtcacacactcacattataatttat |
44380332 |
T |
 |
| Q |
146 |
gattccaggattctctcttttttgcttaatttcttcacaagtcaaattttactactaccttgnnnnnnngttgttagtgcaatgcaagtaagcacagtgt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44380331 |
gattccaggattctctcttttttgcttaatttcttcacaagtcaaattttactactaccttgtttttttgttgttagtgcaatgcaagtaagcacagtgt |
44380232 |
T |
 |
| Q |
246 |
gtcagtcactaaactgaacaacacttct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44380231 |
gtcagtcactaaactgaacaacacttct |
44380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University