View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_35 (Length: 250)
Name: NF14115_low_35
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 24 - 244
Target Start/End: Original strand, 29542179 - 29542399
Alignment:
| Q |
24 |
taactcaatgttgtgcattggtatttatatggaataagtagggtttttggctgtatagcctttacctagacaatcaggatatgttggatccggaccgatg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
29542179 |
taactcaatgttgtgcattggtatttatagggaataagtagggtttttggctgtaaagcctttacctagacaatcaggacatgttggatccgaaccgatg |
29542278 |
T |
 |
| Q |
124 |
ttatgcattggtatttacgagggataaatgtgatattgtgcaatggtatttatgagggatggatatgaccatctagatggtcctatgacatacttaccac |
223 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29542279 |
ttatgcattggtatttatgaaggataaatgtgatattgtgcaatggtatttatgaaggataaatgtgaccatctggatggtcctatgacatacttaccac |
29542378 |
T |
 |
| Q |
224 |
tctgctgaagtaatattcatc |
244 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
29542379 |
tctgctgaagtaatactcatc |
29542399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 24965069 - 24965017
Alignment:
| Q |
19 |
atacctaactcaatgttgtgcattggtatttatatggaataagtagggttttt |
71 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
24965069 |
atacctaactcaatgttgtgcatgagtatttatagagaataagtaaggttttt |
24965017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University