View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_39 (Length: 239)
Name: NF14115_low_39
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 22 - 233
Target Start/End: Original strand, 11851111 - 11851322
Alignment:
| Q |
22 |
atcaattctcatgaaaccaacttcttgaggagaagcacttaattttttgtgtcaagcacatagagattgtttcaagatttagattgattgcaaaccaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11851111 |
atcaattctcatgaaaccaacttcttgaagagaagcacttaattttttgtgtcaagcacatagagattgtttcaagatttagattgattgcaaaccaaga |
11851210 |
T |
 |
| Q |
122 |
aagcatccgaactttgtagatttcatggagatgaattcatgtatacttctttaatacatgtaaaacatataactgtatgtctattagtgtaagaaattgg |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11851211 |
aagcttccgaactttgtagatttcatggagatgaattcatgtatacttctttaatacatgtaaaacatttaactgtatgtctattagtgtaagaaattgg |
11851310 |
T |
 |
| Q |
222 |
tttgaagttcat |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11851311 |
tttgaagttcat |
11851322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University