View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_41 (Length: 238)
Name: NF14115_low_41
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_41 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 6410680 - 6410900
Alignment:
| Q |
18 |
attctaaccgacagatgcataccagattatcctctcggtttattcttcactaatgagaatggttgcctcttgcaatggtatcctttgtttaaacctaata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6410680 |
attctaaccgacagatgcataccagattatcctctcggtttattcttcacttatgagaatggttgcctcttgcgatggtatcctttgtttaaacctaata |
6410779 |
T |
|
| Q |
118 |
aacgattatagcactgaaaccaaactttattcactttgttttgtgggattgcttgtgcatccttgctggatttgttggtttccgatatttgtgcattaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6410780 |
aacgattatagcactgaaaccaaactttattcactttgttttgtgggattgcttgtgcatccttgctggatttgttggtttccgatatttgtgcattaaa |
6410879 |
T |
|
| Q |
218 |
ttcaactgcaactttatgtca |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6410880 |
ttcaactgcaactttatgtca |
6410900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University