View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_43 (Length: 230)
Name: NF14115_low_43
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 27789815 - 27789627
Alignment:
| Q |
17 |
tctcatggcgaattccctctgaaacattatgattgcacacctaaatgcaggttggtggttgagtaacttgaatgtgagaggtgaagatatttgataggga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27789815 |
tctcatggcgaattccctctgaaacattatgattgcacacctaaatgcaggttggtggttgagtaacttgaatgtgagaggtgaagatatttgataggga |
27789716 |
T |
 |
| Q |
117 |
atattcgctacacatatgtcgaaatagggaagttcagtcttcaacacatcgcctattcgccttggataacctgtaatcatcgacaaaaggtaaaact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27789715 |
atattcgctacacatatgtcgaaatagggaagttcagtcttcaacacatc--------gccttggataacctgtaatcatcgacaaaaggtaaaact |
27789627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 1159226 - 1159375
Alignment:
| Q |
17 |
tctcatggcgaattccctctgaaacattatgattgcacacctaaatgcaggttggtggttgagtaacttgaatgtgagaggtgaagatatttgataggga |
116 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||| ||| |
|
|
| T |
1159226 |
tctcatggcaaattctctctggaacattatgattgcacacctaaatgcaggttggtgcttgagtagcttgaatgtgagaggagaagatatttgatacgga |
1159325 |
T |
 |
| Q |
117 |
atattcgctacacatatgtcgaaatagggaagttcagtcttcaacacatc |
166 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
1159326 |
atattcgccacacatatgtcaaaatatggaagttcagtcttcagcacatc |
1159375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University