View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14115_low_6 (Length: 559)
Name: NF14115_low_6
Description: NF14115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14115_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 7e-72; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 188 - 333
Target Start/End: Original strand, 33572591 - 33572736
Alignment:
| Q |
188 |
tataatatgcatgcttatataccttctatgaagaacatcaacaatcctccaatattcatcaatattaaaagatgcctcagcaattttagtcattgttttg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33572591 |
tataatatgcatgcttatataccttctatgaagaacatcaacaatcctccaatattcatcaatattaaaagatgcctcagcaattttagtcattgttttg |
33572690 |
T |
|
| Q |
288 |
gcatcagggctgcaatcatccttatttgttgcttcatcagctagcc |
333 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33572691 |
gcatccgggctgcaatcatccttatttgttgcttcctcagctagcc |
33572736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 452 - 554
Target Start/End: Original strand, 33572862 - 33572964
Alignment:
| Q |
452 |
agtgcataaaaaacacatgtaaaatatacacatacttacaattcagctcctgtaacatctgtaaatgtcatcctagcagatttgtacttttcttgtagaa |
551 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33572862 |
agtgcataaaaaacacatgtaaaatatacacatacttacaattcagctcctgtaacgtctgtaaatgtcatcctagcagatttgtacttttcttgtagaa |
33572961 |
T |
|
| Q |
552 |
aat |
554 |
Q |
| |
|
||| |
|
|
| T |
33572962 |
aat |
33572964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 15 - 112
Target Start/End: Original strand, 33572418 - 33572515
Alignment:
| Q |
15 |
ataggaccatgggtgagcatgaattctagaagaactagtgctttgtaagattgcctccattgttcccaatcaacattgtacaacctgcactttcaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33572418 |
ataggaccatgggtgagcatgaattctagaagaactagtgctttgtaagattgcctccattgttcccaatcaacattgtacaacctgcactttcaatc |
33572515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University