View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14116_high_11 (Length: 220)
Name: NF14116_high_11
Description: NF14116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14116_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 9003449 - 9003629
Alignment:
| Q |
19 |
agactcgacgataacaccaccaatgacaccaatctggtacgtatttgatacaaatatacgtctggataaacaacttaatcaagcactttgttgaatgata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
9003449 |
agactcgacgataacaccaccaatgacaccaatctggtaagtatttgatacaaatatacgtctggataaacaacttaatcaagcacttcgctgaatgata |
9003548 |
T |
 |
| Q |
119 |
cttatgtatatatttatatagaaaataaattggctaaattg--ttgtttattgcaacgaaatcttaggtgtcgaatatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9003549 |
cttatgtatatatttatatagaaaataaattggttaaattgttttgtttattgcgacgaaattttaggtgtcgaatatgat |
9003629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 106
Target Start/End: Complemental strand, 17775569 - 17775541
Alignment:
| Q |
78 |
gtctggataaacaacttaatcaagcactt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17775569 |
gtctggataaacaacttaatcaagcactt |
17775541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University