View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14116_high_9 (Length: 250)
Name: NF14116_high_9
Description: NF14116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14116_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 25626491 - 25626269
Alignment:
| Q |
17 |
actttgaacatgcaactatgttcatacaccttgctttatttgccggtttttcactcttaaccgaattaaccgattcacttgaactcttctctggatttgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25626491 |
actttgaacatgcaactatgttcatacaccttgctttatttgccggtttttcactcttaaccgaattaaccgattcgcttgaactcttctctggatttgt |
25626392 |
T |
 |
| Q |
117 |
tggcatacttgtatcctcagttttcagtcaagagcttttcttacttcattttcattccactgatcatgttggacctgaaggtcattaccactggctgcta |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25626391 |
tgccatacttgtatcctcagttttcagtcaagagcttttcttacttcattttcattccactgatcatgttggacctgaaggtcattaccactggctgcta |
25626292 |
T |
 |
| Q |
217 |
cagctcatagtttttgtctctct |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25626291 |
cagctcatagtttttgtctctct |
25626269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University