View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14116_high_9 (Length: 250)

Name: NF14116_high_9
Description: NF14116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14116_high_9
NF14116_high_9
[»] chr4 (1 HSPs)
chr4 (17-239)||(25626269-25626491)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 25626491 - 25626269
Alignment:
17 actttgaacatgcaactatgttcatacaccttgctttatttgccggtttttcactcttaaccgaattaaccgattcacttgaactcttctctggatttgt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
25626491 actttgaacatgcaactatgttcatacaccttgctttatttgccggtttttcactcttaaccgaattaaccgattcgcttgaactcttctctggatttgt 25626392  T
117 tggcatacttgtatcctcagttttcagtcaagagcttttcttacttcattttcattccactgatcatgttggacctgaaggtcattaccactggctgcta 216  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25626391 tgccatacttgtatcctcagttttcagtcaagagcttttcttacttcattttcattccactgatcatgttggacctgaaggtcattaccactggctgcta 25626292  T
217 cagctcatagtttttgtctctct 239  Q
    |||||||||||||||||||||||    
25626291 cagctcatagtttttgtctctct 25626269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University