View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_38 (Length: 403)
Name: NF14117_high_38
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 3e-58; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 273 - 387
Target Start/End: Complemental strand, 10368546 - 10368432
Alignment:
| Q |
273 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaagctctcgtagaattaaaaattattgtta |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368546 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaagctctcgtagaattaaaaattattgtta |
10368447 |
T |
 |
| Q |
373 |
atgagatgaaacata |
387 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10368446 |
atgagatgaaacata |
10368432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 35 - 132
Target Start/End: Complemental strand, 10368784 - 10368687
Alignment:
| Q |
35 |
aggggtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagcacgggttg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10368784 |
aggggtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagtacgggttg |
10368687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 211
Target Start/End: Complemental strand, 10368636 - 10368608
Alignment:
| Q |
183 |
tggagttcaaagattcagatttgttttct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10368636 |
tggagttcaaagattcagatttgttttct |
10368608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 11659653 - 11659585
Alignment:
| Q |
39 |
gtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| | |||||||| ||||||| |||||||||||| |
|
|
| T |
11659653 |
gtgagatcgaaatgcaaacccataccttgaaatagtagcctccttcttgttcttgctgtccttttcaat |
11659585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 11668822 - 11668754
Alignment:
| Q |
39 |
gtgagatcgaaatgcaaacccatacctagaaatagtaacttccttcttcttcttgccgtccttttcaat |
107 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| | ||||||||||| |||| |||||||||||| |
|
|
| T |
11668822 |
gtgagatcgaaatgcaaaccgataccttgaaatagtagcctccttcttctttttgctgtccttttcaat |
11668754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 124
Target Start/End: Complemental strand, 53239290 - 53239235
Alignment:
| Q |
69 |
aatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagc |
124 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
53239290 |
aatagtagcttctttcttcttcttgctgtccttttcaattttcagaccactgcagc |
53239235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 124
Target Start/End: Complemental strand, 2170405 - 2170350
Alignment:
| Q |
69 |
aatagtaacttccttcttcttcttgccgtccttttcaattttcataccactacagc |
124 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
2170405 |
aatagtagcttctttcttcttcttgctgtccttttcaattttcagaccactgcagc |
2170350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University