View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_39 (Length: 394)
Name: NF14117_high_39
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 7056403 - 7056090
Alignment:
| Q |
1 |
gtttgagaaacatcgcatataacaaaatgaaagagagctttctctagctacatgcaattgattcttattaattacaatttacaaggttgttctactgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7056403 |
gtttgagaaacatcgcatataacaaaatgaaagagagctttctctagctacatgcaattgattcttattaattacaatttacaaggttgttctactgcaa |
7056304 |
T |
 |
| Q |
101 |
cgatcaagattgctttttggaacattcatctttactaatgatgtgtttggaaccacatttgggatccctccaaagtttaaacgtacgaaattgaaatgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7056303 |
cgatcaagattgctttttggaacattcatctatactaatgatgtgtttggaaccacatttgggatccctccaacgtttaaacgtacgaaattg-aatgct |
7056205 |
T |
 |
| Q |
201 |
ccaatttatagcctttatgcactggtaactgtgagagacgtgagtttgggatacaaaacggcaaaccagacacatactagttaacgaatttacgttaaga |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7056204 |
ccaatttagagcctttatgcactggtaactgt--gagacgtgagtttggg-tacaaaacggcaaaccagacacatactagttaacgaatttacgttaaga |
7056108 |
T |
 |
| Q |
301 |
tatgtagcaatatttaac |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7056107 |
tatgtagcaatatttaac |
7056090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 334 - 365
Target Start/End: Complemental strand, 7056088 - 7056057
Alignment:
| Q |
334 |
tactgttggtgcaggcggcagttgtgaaaacc |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7056088 |
tactgttggtgcaggcggcagttgtgaaaacc |
7056057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University