View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_54 (Length: 328)
Name: NF14117_high_54
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 310
Target Start/End: Complemental strand, 28954771 - 28954454
Alignment:
| Q |
10 |
attattctgctcaattagaacctcttggtttgccagcctcgtacgtgtacattaacatgtaagcaaataaggcgggacagatagcaacttctt---tgat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28954771 |
attattctgctcaattagaacctcttggtttgccagcctcgtacgtgtacattaacatgtaagcaaataaggcgggacagatagcaacttcttctttgat |
28954672 |
T |
 |
| Q |
107 |
ttcggacgtaactatgatcgtcaaatacagcataagtggtgtttgccgcgacttgtttcaaagcttcttactggttggaagcat----tactaacagttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28954671 |
ttcggacgtaactatgatcgtcaaatacagcataagtggtgtttgccgcgacttgtttcaaagcttcttactggttggaagcattacttactaatagttg |
28954572 |
T |
 |
| Q |
203 |
gagtatttctaatcactcatatcatatgcaatagaaatttgtactcaccaaataattct---------------actttatacacaaattatccgttata |
287 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28954571 |
gagtatttctaatcac-----tcatatgcaatagaaatttgtactcaccaaataattctactttaatcatatgaactttatacacaaattatccgttata |
28954477 |
T |
 |
| Q |
288 |
aactagtcgttggaccgtcaaat |
310 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28954476 |
aactagtcgttggaccgtcaaat |
28954454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University