View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_68 (Length: 266)
Name: NF14117_high_68
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_68 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 43409216 - 43408966
Alignment:
| Q |
16 |
cagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttggttgttgtgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409216 |
cagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttggttgttgtgaa |
43409117 |
T |
 |
| Q |
116 |
ggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataacaagctgaatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409116 |
ggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataacaagctgaatca |
43409017 |
T |
 |
| Q |
216 |
accgttgatatgcagcaactcatagttgaaacaccacaacctgatgcacca |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409016 |
accgttgatatgcagcaactcatagttgaaacaccacaacctgatgcacca |
43408966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University