View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_72 (Length: 254)
Name: NF14117_high_72
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 1249224 - 1249449
Alignment:
| Q |
17 |
agttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaaggcctagttaactaaagggatgcatgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1249224 |
agttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaagacctagttaactaaagggatgcatgc |
1249323 |
T |
|
| Q |
117 |
ttaataaatggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggatagtctacatgtttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1249324 |
ttaataaatggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggatagtct--atgtttta |
1249421 |
T |
|
| Q |
217 |
agtacgttctcatcttcttaagtattat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1249422 |
agtacgttctcatcttcttaagtattat |
1249449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 86
Target Start/End: Complemental strand, 12079030 - 12078961
Alignment:
| Q |
17 |
agttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttg |
86 |
Q |
| |
|
||||||||||||||||||| |||| |||| | ||||||||||||| |||||| |||| ||| ||||||| |
|
|
| T |
12079030 |
agttgcaagggtttgatccatcgtcgttttcgcataataagtgtttgtgtggttctcctttgcccccttg |
12078961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University