View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_80 (Length: 245)
Name: NF14117_high_80
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_80 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 15689530 - 15689303
Alignment:
| Q |
16 |
tcaacaacgtggctatcaactgcttcggcagcatttgatcaaacccttgaagggaataacacaacttttcaagtccaggtgcattacccatcctattcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15689530 |
tcaacaacgtggctatcaactgcttcggcagcatttgatcaaacccttgaagggaataacacaacttttcaagtccaagtgcattacccatcctattcat |
15689431 |
T |
 |
| Q |
116 |
gggtttcaagagagatgttgattaatggattcggtacaagaaaattttccataacactcttatgctttaatcaatatccctcattgctattttaatattc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689430 |
gggtttcaagagagatgttgattaatggattcagtacaagaaaattttccataaca--cttatgctttaatcaatatccctcattgctattttaatattc |
15689333 |
T |
 |
| Q |
216 |
ttatgctttaattgaaaatgatctaaagta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15689332 |
ttatgctttaattgaaaatgatctaaagta |
15689303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University