View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_82 (Length: 240)
Name: NF14117_high_82
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 22 - 229
Target Start/End: Original strand, 51432026 - 51432233
Alignment:
| Q |
22 |
aagtgtttttaaagagtgtgttactaacgctcctctttagtagtaataatataataaaagagatagcaccttgcatcctgcaaatggaactcttctcagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51432026 |
aagtgtttttaaagagtgtgttactaacgctcctctttagtagtaataatataataaaagagatagcaccttgcatcctgcaaatggaactcttctcagc |
51432125 |
T |
|
| Q |
122 |
agcaggaaaaccaactgatgggggagaaggcaaattgtcagagtttccttgtggagaagaaggggtggtactggaaaagagtgaattgaagggaattcca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51432126 |
agcaggaaaaccaactgatgggggagaaggcaaattgtcagagtttccttgtggagaagaaggggtggtactggaaaagagtgaattgaagggaattcca |
51432225 |
T |
|
| Q |
222 |
cttttcat |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
51432226 |
cttttcat |
51432233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University