View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_83 (Length: 238)
Name: NF14117_high_83
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 50389257 - 50389032
Alignment:
| Q |
1 |
aataactattacacatgaaagcactcaattgggttcgaccacgaatgatttagacaccataaccaatgtcttgaaattgttttatgcaaccaccacaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50389257 |
aataactattacacatgaaagcactcaattgggttcgaccacgaatgatttagac--cataaccaatgtcttgaaattgttttatgcaaccaccacaaat |
50389160 |
T |
 |
| Q |
101 |
gtagtttcccctatccacaatatccgctacccatgattctttttgacaaaatctattattgtgtttcttccaaatttgtcaaatgcacgctagccaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50389159 |
gtagtttcccctatccacaatatccgctacccatgattctttttgaaaaaatctattattgtgtttcttccaaatttgtcaaatgcacgctagccaaact |
50389060 |
T |
 |
| Q |
201 |
acttggagcctttccattgatacctttg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
50389059 |
acttgaagcctttccattgatacctttg |
50389032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University