View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_high_91 (Length: 205)
Name: NF14117_high_91
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_high_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 23801580 - 23801747
Alignment:
| Q |
18 |
atacgaacaaaaatggaccaactaaaaccaaaggttcttaattagttggaatatattcccttcaaatcatccctttgctccaaactttattaggaaaatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23801580 |
atacgaacaaaaatggaccaactaaaaccaaaggttcttaattagttggaatatattcccttcaaatcatccctttgctccaaactttattgggaaaatt |
23801679 |
T |
 |
| Q |
118 |
cagtcggaagaagaaaattcatcttgtgtgtttcatagattctccgacataaatcaatcacggttaaa |
185 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
23801680 |
cagtgggaagaagaaaactcatcttatgtgtttcatagattctcccacatagatcaatcacggttaaa |
23801747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University