View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_low_35 (Length: 416)
Name: NF14117_low_35
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 5e-26; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 83 - 203
Target Start/End: Complemental strand, 3128510 - 3128390
Alignment:
| Q |
83 |
aaatgtttgttcaaatgagagtaagaaaaaagactatctgcattctacaatggacactataagctttttcacgagttttggttcttatgttttcctagtt |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| ||||| |||||||| | |||||||| ||||||||| || |||||||| |||||||||||| ||||| |
|
|
| T |
3128510 |
aaatatttgttcaaatgagagtaagaaacaaggctatcggcattctatattggacactgtaagcttttccatgagttttgcctcttatgttttcttagtt |
3128411 |
T |
 |
| Q |
183 |
ttttatgtaaaaggcaatgtt |
203 |
Q |
| |
|
| ||| |||||||||||||| |
|
|
| T |
3128410 |
tactatttaaaaggcaatgtt |
3128390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 2987807 - 2987889
Alignment:
| Q |
121 |
tgcattctacaatggacactataagctttttcacgagttttggttcttatgttttcctagttttttatgtaaaaggcaatgtt |
203 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||| ||||||| ||||||||||| |||||| |
|
|
| T |
2987807 |
tgcattctacagtggacactataagccttttcacgagttttgcttcttatgttttcatagttttctatgtaaaaggaaatgtt |
2987889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 133 - 203
Target Start/End: Original strand, 3291535 - 3291605
Alignment:
| Q |
133 |
tggacactataagctttttcacgagttttggttcttatgttttcctagttttttatgtaaaaggcaatgtt |
203 |
Q |
| |
|
||||||| |||||||||||| |||||||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
3291535 |
tggacaccgtaagctttttcatgagttttgcttcttatgtttttctagttttctatgtaaaaggcaatgtt |
3291605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University