View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_low_77 (Length: 256)
Name: NF14117_low_77
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_low_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 70 - 243
Target Start/End: Complemental strand, 32593300 - 32593140
Alignment:
| Q |
70 |
acaaaacaagatggttcaagagcctaaatgcatcagccagaatttcaattgcaaatttagtacataacattaggcagccaatatgttcaaatatttttgc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32593300 |
acaaaacaagatggttcaagagcctaaatgcatcagccagaatttcaattgcaaatttagtacataacattaggcagccaata-----------ttttgc |
32593212 |
T |
|
| Q |
170 |
aatatagtatcagtttttaaaatcttttaatgtaacatagtcaatatcctttattttgtatttacagtaataag |
243 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32593211 |
actatagtatcagtttttaaaatcttttaatgtaacatagtcaatatccttta--ttgtatttacagtaataag |
32593140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 149 - 206
Target Start/End: Complemental strand, 32604050 - 32603993
Alignment:
| Q |
149 |
aatatgttcaaatatttttgcaatatagtatcagtttttaaaatcttttaatgtaaca |
206 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32604050 |
aatatgtacaaatagttttgcaacatagtatcattttttaaaatcttttaatgtaaca |
32603993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 32604811 - 32604769
Alignment:
| Q |
23 |
caaataaccaaagtgaaggaccctaaagtaagtaaggttatga |
65 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
32604811 |
caaataaccaaagtgaaagaccctaaattaactaaggttatga |
32604769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University