View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_low_84 (Length: 248)
Name: NF14117_low_84
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 5032901 - 5032660
Alignment:
| Q |
1 |
tagtacttaattagttgtgaatcttgtgataccattttgctagtggaaggaaaaaatatatgaatatgaaggacgacaaatatttatatttc-ttttacg |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5032901 |
tagtacttaaatagttgtgaatcttgtgataccattttgctagtggaaggaaaaaatatatgaatatgaaggacgacaaatatttatatttctttttacg |
5032802 |
T |
 |
| Q |
100 |
cacatgttagtatggttctctctttatattactgctagagtgattctttacctatcacacataattgtttcacttaatgtgctctagttgacaattttca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5032801 |
cacatgttagtatggttctctctttatattactgctagagtgattctttacctatcacacataattgtttcacttaatgtg--ctagttgacaattttca |
5032704 |
T |
 |
| Q |
200 |
agcacttataacaacttgtcaattttcaattactatattcttgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5032703 |
agcacttataacaacttgtcaattttcaattactatattgttgt |
5032660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University