View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14117_low_91 (Length: 237)

Name: NF14117_low_91
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14117_low_91
NF14117_low_91
[»] chr1 (1 HSPs)
chr1 (1-223)||(5032991-5033215)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 5032991 - 5033215
Alignment:
1 aaaacggcactatttgtaaaaggattagggaaaatctaaaacagtgtcgttaattagtgcgatgaaaccttccataacgattgtaaccnnnnnnnnnnnn 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                
5032991 aaaaaggcactatttgtaaaaggattagggaaaatctaaaacagtgtcgttaattagtgcgatgaaaccttccataacgattgtaaccaaaaaaaaaaaa 5033090  T
101 nn--cttccataacgacaacaactatttgattccttttacacataacataaatactctaatagggacagggatatctattatctattagggttttataga 198  Q
        ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
5033091 aaaccttccataaggacaacaactatttgattccttttacacataacataaatactctaatagggacagggatatctattatccattagggttttataga 5033190  T
199 aaaataaagactccttatattttgt 223  Q
    |||||||||||||||||||||||||    
5033191 aaaataaagactccttatattttgt 5033215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University