View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_low_92 (Length: 235)
Name: NF14117_low_92
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_low_92 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 67 - 200
Target Start/End: Original strand, 8065834 - 8065967
Alignment:
| Q |
67 |
ttcaactatgataccatcttagattgaacctaattcatccaatcatccttatcatataggtttcagaaatgatatgtgaacatcattttctgacaaccga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||| || |
|
|
| T |
8065834 |
ttcaactatgataccatcttagattgaacctaattcatccaatcatccttatcatataggtttcagaaatgatacgtgaacatccttttgtgacaactga |
8065933 |
T |
 |
| Q |
167 |
caatgtatttacatacggtcggatacgaattgcc |
200 |
Q |
| |
|
||| |||| |||||| |||||||||||||||||| |
|
|
| T |
8065934 |
caacgtatatacatatggtcggatacgaattgcc |
8065967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University