View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14117_low_92 (Length: 235)

Name: NF14117_low_92
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14117_low_92
NF14117_low_92
[»] chr7 (1 HSPs)
chr7 (67-200)||(8065834-8065967)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 67 - 200
Target Start/End: Original strand, 8065834 - 8065967
Alignment:
67 ttcaactatgataccatcttagattgaacctaattcatccaatcatccttatcatataggtttcagaaatgatatgtgaacatcattttctgacaaccga 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||| ||    
8065834 ttcaactatgataccatcttagattgaacctaattcatccaatcatccttatcatataggtttcagaaatgatacgtgaacatccttttgtgacaactga 8065933  T
167 caatgtatttacatacggtcggatacgaattgcc 200  Q
    ||| |||| |||||| ||||||||||||||||||    
8065934 caacgtatatacatatggtcggatacgaattgcc 8065967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University