View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14117_low_98 (Length: 210)
Name: NF14117_low_98
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14117_low_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 40575484 - 40575661
Alignment:
| Q |
13 |
aatataaacctattgacgatagcagatagctcttttgtactactattttgagcatggttccaactattagttcattcaaattctgttttatttatggata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40575484 |
aatataaacctattgacgatagcagatagctcttttgtactactattttgagcatggttccaactattagatcattcaaattctgttttatttatggata |
40575583 |
T |
 |
| Q |
113 |
aactgtctagcttccttgttttttgaatttcctgtactcacccattcatggaagcaatgaaaattgctaagtagaagg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40575584 |
aactgtctagcttccttgttttttgaatttcctgtactcacccattcatggaagcaacgaaaattgctaagtagaagg |
40575661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University