View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_high_24 (Length: 301)
Name: NF14118_high_24
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 45453025 - 45452779
Alignment:
| Q |
19 |
ctcaagtcatgctacgaaggagagatattggtgaattggtgactcagtggagatggaagtgacctgatggttcgaagctttttatgggtatgaaatagnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45453025 |
ctcaagtcatgctacgaaggagagatattggtgaattggtgactcagtggagatggaagtgacctgatggttcgaagctttttatgggtatgaaatagtt |
45452926 |
T |
|
| Q |
119 |
nnnnnnn-gtatgcaggaaagaggcgccacaattgctagaggggacaacagggtgaaggtagatgggagagagaacatttttcatgagatagagattgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45452925 |
ttttttttgtatgcaggaaagaggcgccacaattgctagaggggacaacagggtgaaggtagatgggagagagaacatttttcatgagatagagattgtg |
45452826 |
T |
|
| Q |
218 |
tgcgggctaatggagaaagagctcactaggttaaagagataaatata |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45452825 |
tgcgggctaatggagaaagagctcactaggttaaagagataaatata |
45452779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University