View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14118_high_30 (Length: 262)

Name: NF14118_high_30
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14118_high_30
NF14118_high_30
[»] chr6 (2 HSPs)
chr6 (1-78)||(30428459-30428536)
chr6 (213-252)||(30428303-30428342)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 30428536 - 30428459
Alignment:
1 aaacattatggttgagcggtttccttttgttatcccttttcttttagggttgagtttgggtcagacttctttggagtg 78  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||    
30428536 aaacattatggttgagccgtttccttttgttatcccttttcttttaggggtgactttgggtcaggcttctttggagtg 30428459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 213 - 252
Target Start/End: Complemental strand, 30428342 - 30428303
Alignment:
213 tcttggtttttcgaattccaatctcaacaataatcctttg 252  Q
    ||||||||||| ||||||||||||||||||||||||||||    
30428342 tcttggttttttgaattccaatctcaacaataatcctttg 30428303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University