View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14118_high_31 (Length: 260)

Name: NF14118_high_31
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14118_high_31
NF14118_high_31
[»] chr5 (4 HSPs)
chr5 (132-241)||(43383301-43383410)
chr5 (133-241)||(25870023-25870131)
chr5 (1-104)||(43383185-43383282)
chr5 (76-104)||(25869981-25870009)


Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 241
Target Start/End: Original strand, 43383301 - 43383410
Alignment:
132 gaacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatgcgttgtcatcctgagcgtgaatggaga 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43383301 gaacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatgcgttgtcatcctgagcgtgaatggaga 43383400  T
232 ggcattaacc 241  Q
    ||||||||||    
43383401 ggcattaacc 43383410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 133 - 241
Target Start/End: Original strand, 25870023 - 25870131
Alignment:
133 aacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatgcgttgtcatcctgagcgtgaatggagag 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
25870023 aacaacattgctcgtacttgcactgaatgtggtaagatattctggtcatggaaggctctttttggtcatatgcgttgtcatcctgagcgtcaatggagag 25870122  T
233 gcattaacc 241  Q
    |||||||||    
25870123 gcattaacc 25870131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 43383185 - 43383282
Alignment:
1 gataaaaattggtccgatgatcatagtagtggtgatcaatacaggatgaaagatgattctgttaatgttactggtaagaagaagcgtaaggaattgggtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||      || ||||||||||||||||||| |||||||||||||||    
43383185 gataaaaattggtccgatgatcatagtagtggtgatcaatacaggatgaaagatga------tactgttactggtaagaagaagagtaaggaattgggtg 43383278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 104
Target Start/End: Original strand, 25869981 - 25870009
Alignment:
76 aagaagaagcgtaaggaattgggtgggga 104  Q
    |||||||||||||||||||||||||||||    
25869981 aagaagaagcgtaaggaattgggtgggga 25870009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University