View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_low_29 (Length: 291)
Name: NF14118_low_29
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_low_29 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 103494 - 103774
Alignment:
| Q |
1 |
ttatctgcacaacattggtatagcagaattggaatttacctcattggtgaaaatgttattggaatttaccttaa---tgttgtgtatgcaaaaatttgaa |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
103494 |
ttatctgcacaacattgatatagcagaattggaatttacctcattggtgaaaatgttattggaatttaccttaatattgttgtgtatgcaaaaatttgaa |
103593 |
T |
 |
| Q |
98 |
actgtcttattgcagaatagattctatttatgcaaaggaaagttaaatgataacg---nnnnnnnntcaaaatgcttataccacagttctttgtgatcca |
194 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| |||||| ||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
103594 |
actgtcttatcgcagaattgattctatttatgcaaaagaaagtaaaatgataacgaaaaaaaaaaatcaaaatgtttataccacagttctttgtgatcca |
103693 |
T |
 |
| Q |
195 |
gctgcatcttttcaattcaccatgctcggccgcgtgtggattttgttgttgctgtgaaatattaataagtgtatgttctct |
275 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103694 |
gctgcatcttttcaattcaccaagctcagccgcgtgttgattttgttgttgctgtgaaatattaataagtgtatgttctct |
103774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University