View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14118_low_30 (Length: 272)
Name: NF14118_low_30
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14118_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 10619582 - 10619827
Alignment:
| Q |
17 |
acatggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcgtggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10619582 |
acatggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcggggt |
10619681 |
T |
 |
| Q |
117 |
ggagtgtgaaaagatgagatgggtcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatga |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619682 |
ggagtgtgaaaagatgagatggatcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatga |
10619781 |
T |
 |
| Q |
217 |
tccgatgaatccgtttgctccggttacgcataccacctcttctctg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619782 |
tccgatgaatccgtttgctccggttacgcataccacctcttctctg |
10619827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University